Analysis of the Cotton E6 Promoter

TSINGHUA SCIENCE AND TECHNOLOGYISSN 1007-0214 01/20 pp409-413Volume 10, Number 4, August 2005Analysis of the Cotton E6 PromoterWU Aimin (吴蔼民), LIU Jinyuan (刘进元)”Department of Biological Sciences and Biotechnology, Tsinghua University, Bijing 100084, ChinaAbstract: An E6 gene from sea island cotton (Gossypium barbadense) was expressed specifially in cottonfiber cells to transfer functions to cultivated species for better transgenic engineering. The regulatory activityof the E6 promoter region was then studied by isolating a 614-bp fragment of the 5 -flanking region fromupland cotton (Gossypium hirsutum CRI-12) to produce a green fluorescent protein (GFP) reporter constructfor analysis of tissue-specific expression in transgenic tobacco seedlings. Fluorescent analyses indicate thatthe relatively short E6 promoter is sufficient to direct green fluorescent protein expression specifcally in theleaf trichomes (hair cells) of the transgenic tobacco plants. As cotton fibers are also unicellular trichomes thatdifferentiate from epidermal cells of developing cotton ovules, the result suggests that the relatively short E6promoter can serve as a fiber-specific expression promoter for genetic engineering to improve cotton fiberquality.Key words: cotton E6 promoter; green fluorescent protein florescence; trichome-specific expression;transgenic tobaccoonly an economically important commodity, but alsoIntroductionan excellent experimental model for studying plant cellelongation and wall biogenesis. Fiber-specific genesunicellular trichomesand their regulatory elements were investigated as adifferentiate from epidermal cells of developing cottonovules. They have four distinct developmental stages:fiber morphogenesis for improving cotton fiber quality.fiber initiation， cell elongation， secondary wallMany genes are known to be transcriptionally regulateddeposition，andFiber cells fromduring fiber development' ; however, because of theGossypiumn hirsutum (G. hirsutum), the cotton varietylong period required to regenerate transgenic cottonsmost commonly grown in China， range in diameterand the lack of suitable transient assay systems, progressfrom 11 to 22 μm and in length from 2.1 to 3.3 cm,in characterizing cotton fiber- specific promoters has1000 to 3000 times longer than their width. In additionbeen slow, and comparatively little is known about cisto being amongelements in cotton fiber promoters. To circumventcharacterized, the wall cellulose of a single cellhe difficulties of regenerating cotton， heterologousaccounts for more than 95% of the dry weight 0systems were used to determine if fiber-specificmature cotton fiber'. Therefore, cotton fibers are notpromoters conferred leaf trichome-specific expressionin other plants. Studies of these promoter regions inReceived: 2003-12- 15; revised: 2004-03-04plants such as tobacco and Arabidopsis have shownSupported by the National High-Tech Research and Developmentthat cotton fibers and tobacco or Arabidopsis trichomes,(863) Program of China Nos. 2001AA222053, 2002AA212051,which all belong to differential epidermal cells, maynd2002AA207006) and the National Natural ScienceFoundation of China (No. 30270753)share common中国煤化Iissue-specificr * To whom crrespondence should be adressed.expression'b-9l.YHCNMH G .E-mail: liujy @ mail.tsinghua.edu.cn; Tel: 86 10-62772243.410Tsinghua Science and Technology, August 2005, 10(4): 409- 413An E6 gene from sea island cotton (G. barbadense)extraction kit was from Qiagen, and all other chemicalshas been to expresss specifically in cotton fiber cells'swere domestic products of analytical grade.To test whether the promoter of the E6 gene could be.2 Promoter-GFP fusion and plantutilized to express heterologous proteins intransformationtissue-specific manner in cotton, John and Crowgenerated transgenic cotton plants containing a 2.5-kbGenomic DNA from the seven- day-old cottonDNA fragment of the upstream sequence from the firstseedlingswas prepared according to the methodinitiation code of the E6 gene fused with the codingreported by Paterson et al.and used as a templateregion of the carrot expressing gene to show that theto produce a 614-bp fragment of the 5 -flanking regionmaximal extension RNA concentration was found inof the E6 gene by polymensse chain reaction (PCR)15- to 20-day postanthesis (DPA) transgenic cottonamplification with the following two oligonucleotidefibers and that the expression pattern is similar to thatprimers: the 5" primer 5' -CGAAGCTTAAATTATACCof E6 expression. However, the detailed regulatoryATACCTCACG-3' and the 3' primer 5' -ATGGATCCelements of the E6 promoter remain unknown. We areGGCTATGGTTGCTAATGC-3'. A Hind restrictioninterested in developing a fiber- specific promoter foenzyme site (AAGCTT) was created at the 5 end ofgenetic engineering to improve cotton fiber quality.the 5’ primer and a BamHI site (GGATCC) wasThe experimental strategy used for developinggenerated at the 5’end of the 3’primer. Thfiber-specific promoter was to isolate a genomic DNAHind. _BamHI fragment of the PCR product wasfragment of the 5 -flanking region from the cottonligated into the corresponding site of the binarypBI121 vector (Clontech) containing the GFP codingvariety grown in China and to then use thheterologous system to determine if the fiber-specificsequence by removing the CaMV 35S promoter frompromoter region regulates leaf trichome- specificthe original plasmid. The result was sequenced t(expression in tobacco plants. In this study， the 5 -confirm the cloning of the E6 promoter region. Asflanking region (from - -581 to +33) from G. hirsutumshown in Fig. 1, in addition to the short E6 promoterCRI-12 was tested for promoter activity in transgenicregion and a GFP coding sequence, the vector containstobacco plants. When fused with the GFP gene, thea gene for kanamycin resistance as a selectable marker614-bp E6 promoter region exhibited tissue-specificgene. The vector was designated as pBI-E6-GFP. Thegreenfluorescent protein (GFP) expression ipBI121 vector with 35S promoter and GFP report genewas used as a positive control.transgenic tobacco seedlings. GFP fluorescence wasRBHindll BamHILEfound only in trichomes of young tobacco leaves.These results demonstrate that cotton fibers and-~tobacco trichomes may share common regulatoryelements for tissue- specific expression as they areFig. 1 Schematic diagram of the pBI-E6-GFP plasmid.both differentiated epidermal cells.A 614-bp fragment of the E6 promoter (PE6) wasfused with the GFP gene in pBI121. Pnos and Tnos1 Materials and Methodsindicate the promoter and the terminator of thenopaline synthase gene, respectively. Kan' represents1.1 Plants and chemicalsthe kanamycin resistant gene. RB is the right borderand LB is the left border sequences of the Ti plasmid.The upland cotton (G. hirsutum CRI-12) seeds wereprovided by the Cotton Research Institute of theThe pBI-E6-GFP plasmid was introduced intoChinese Academy of Agriculture and planted in aAgrobacterium tumefaciens LBA4404 using agreenhouse. Tobacco plants (Nicotiana tabacum (Nfreeze-thaw method. Leaf discs of tobacco (N.tabacum) cv. NC89) used for agro-infection were alsotabacum cv. NC89) were transformed as described bygrown in the greenhouse. Taq polymerase and the TAHorsch et al." 1 A parallel transformation was carriedcloning kit were purchased from Promega， thout with a cons中国煤化Iromoter fusedrestriction enzymes were from GIBCO-BRL, the geltotheGFPMHC N M H Gmed tobacco.WU Aimin (吴蔼民) et al: Analysis of the Cotton E6 Promoter411plants were selected on MS medium containing2 Results and Discussion100 i g/mL kanamycin and 200 i g/mL carbenicillin,with the integration of the fusion constructs confirmed2.1 Characterization of the relatively short E6promoter regionby PCR..3 Detection of GFP protein with fluorescentA 614-bp fragment was obtained from G. hirsutum cv.microscopyCRI-12 by PCR (Fig. 2). Compared with the E6promoter from sea island cotton (G. barbadense)" ，theYoung leaves of non-transformed and transgenic614-bp fragment had only two mutation sites: attobacco plants were cut with the GFP fluorescence of-170 bp site, G instead of C; and at -182 bp site, Athe leaves used to monitor the fluorescence under ainstead of C. Therefore, the promoter sequences werefluorescence phase microscope (Olympus Fluoviewhighly conserved in the different cotton varieties. AsConfocal Laser Scanning Biological Microscopeshown in Fig. 2, the sequence contains 581 bp of theFV500，Japan) after excitation with light at 460 topromoter region and 33 bp of the 5 -noncoding region. .500 nm wavelengths. The emitted fluorescence wa:The A nucleotide of the transcriptional start side isimaged on a computer, with a filter used to detect thenumbered as +1. A TATA box is present at 35 basesfluorescence at wavelengths longer than 510 nm.upstream from the transcription start site, with a CAATConfocal images of GFP were acquired sequentially,box located at the -122 bp position. These two boxesusing the same instrument for experimental and controlmay serve as basal elements for the transcription.samples.-581 AATTATACCATACCTCACGATGTGGTAGTAATTTACATATTTGAAMOYB-box-521 AATICATAAATACTAATCAGCTTTCTTGAATACTAAGATATAATTATTACAATPSE'-box-461 TATAATATGTAGGTTCAAATCTATCATGTGTATATTTGTACTATATTCTATATAAT01 TCATACCTTATAAACTATCTATTTAGTTATGGTTGATTGATCEATACAATT341 TATTAAAATTAATATTAGTAAAGATATATAGTAAACTAAACAAATTTTATATG-281 TAGAATAGCGAAAAATATCATATTTGTAGACTTTACCAGTGTGGGAGAATG-221 GGATCATTACAGAAAATGAATATATATATACATAAGAAGCGTCC11-box PSE"-oxYB-bexPSE-box- 161 TTTGATAGTIGTTATTGGTGTATGTGAGGGACCACAATCATCACCATTCACCACTI-box .-101 TGCTCCTAATTGAGTTAATCTTTTACAACATAGAAACTAGAAGATCCCTTCTT-41 GCTTCATATATATACATTTCTATCATCCATTTCACATCACACACACAAGTAACCAT+ 20 TAGCACCATACCCFig.2 The 5'-flanking region of the E6 gene. The transcription start site is designated as +1. The oligonucleotideprimers used for PCR amplification are underlined by dashed lines.The promoter region was studied with the onlinefunctionally important in many light-regulated plantPLACE program (http://www.dna.ffrc.go.jp/htdocs/promoters . This suggests a possible effect of lightPLACE/)'which demonstrated the presence of aon the E6 promoter light-regulated gene expression.number of potential regulatory sequences, such as lightThe PSE box (core element AGAAA) and the PSEresponsive elements， regulatory regions for latebox are frequently observed in the regulatory regionspollen-specific genes, two MYB boxes, and an OSEof late pollen-specific genes. The MYB box (corebox. The light responsive elements I-box (core elementelement TAAated element中国煤化工GATAA) and GT1-box (core element GGAAAA) arerequired for trand the OSETYHCNMHG.412Tsinghua Science and Technology, August 2005, 10(4): 409- 413)0X (core element TACTAT) acts as a dominantpBI-E6-GFP (Figs. 4b and 4c), with no GFP activitynegative cis-acting module for the control 0detected in the leaf tissues of wild type tobacco plantsorgan-specificexpression"。The transcriptional(Figs.4b and 4c). In the positive control with plantsregulation of gene expression in plants can btransformed with pBI121 containing the 35S promoter,mediated by interactions between sequence-specificthe GFP fluorescence occurred in all areas includingtranscription factors and their regulatory elements,he trichome cells (Fig. 4d)， which indicatedwhich are generally located in the 5' -upstream regions.nonspecific tissue expression.These resultsThese elements described here may play roles indemonstrate that a 614-bp promoter region possessesvarious regulatory functions including spatial,trichome-specific promoter activities and is sufficienttemporal, and environmental controls of expression.to direct GFP expression in the transgenic tobaccoHowever, the detailed regulatory functions of theseplants. However, the relationship between the trichomeelements in the E6 promoter remain to be investigated.expression in tobacco leaves and the expression ircotton fibers remains to be determined.2.2 Trichome-specific GFP expression intransgenic tobacco plantsThe tissue expression pattern of the E6 promoter was200 umexamined in transgenic tobacco plants through thestudy of a 614-bp promoter region (from -581 to +33).The promoter region was ligated into the GFP reporter200umgene in a translationally fused manner, and introducedinto tobacco plants via Agrobacterium-mediatedtransformation. Transgenic lines harboring thconstruct pBI121 with 35S promoter fused GFP were50 umalso made for comparison. Ten regenerated plants werePCR-verified for the presence of the report GFP gene.As shown in Fig. 3, most had a unique band whichindicates the presence of a GFP gene in most of theFig.4 Fluorescent microscopy observation of GFP intransgenic plants. These PCR- positive tobacco plantsthe leaves of transgenic and wild type tobacco plants.were selected for fluorescent microscopy assays.Autofluorescence is shown in the left column, thecorresponding transmission views of the same fields inMCK1CK2T1T2T3T4T5T6T7T8T9T10the left column are shown in the middle column, andthe right column is the overlap of the left and middlebpcolumns. No GFP expression was detected in the wild1000type tobacco plants (row a). The GFP gene was1998expressed only in the leaf trichomes of transgenic250tobacco plants (rows b and c) but was expressed60throughout the whole leaf of the transgenic tobaccoplant with 35S promoter and the GFP gene (row d).Fig.3 Regenerated tobacco plants were PCR testedfor the GFP report gene. Of the ten plants, eight hadConclusionsan amplified unique band with 730 bp. M representsDNA markers, CK1 represents the positive control ofThe promoter function of several cotton fiber genesthe GFP gene, and CK2 represents the non-transgenicwas analyzed in transgenic cotton plants and othertobacco control. T1-T10 correspond to ten individualplant systems. A 447-bp 5' -flanking region of the Ltp6transgenic tobacco plants containing the pBIE6-GFP.gene was shown to direct the β -glucuronidaseIn the fluorescent analyses, the GFP expression wasexpression in tobacco leaves in a trichome-specificvisualized only in the basal stump of the leaf trichomesregulated man中国煤化工moter can bef the transgenic tobaccoplantscontainingused to direcression in aTYHCNMH G.WU Aimin (吴蔼民) et al: Analysis of the Cotton E6 Promoter413tissue-specific manner in cotton fiber cells' . This[9] Liu H C, Creech R G, Jenkins J N, Ma D P. Cloning andstudy further shows that the 614-bp 5' -flanking regionpromoter analysis of the cotton lipid transfer protein geneof the E6 gene， when fused with the GFP geneLpt3. Biochem. Biophys. Acta, 2000, 1487: 106-111.(pBI-E6-GFP)，can regulate tissue- specific GFP[10] Paterson A H, Brubaker C L, Wendel J F. A rapid methodexpression in transgenic tobacco plants. The GFPfor extraction cotton C (Gossypium spp) genomic DNAfluorescence was only observed in trichomes osuitable for RFLP or PCR analysis. Plant Moleculartransgenic young leaves. The result indicates that theBiology Reporter, 1993, 11(2): 122-127.614-bp E6 promoter region contains all of the[11] Walkerpeach C R, Velten J. Agrobacterium- mediated genenecessary regulatory elements for tissue andtransfer to plant cells: Co-integrate and binary vectordevelopmental regulation. Therefore， this minisystems. In: Gelvin S B, Schilperoort R A, eds. Plantpromoter will be a valuable tool in the geneticMolecular Biology Manual. Kluwer, Dordrecht, 1994, B1:engineering to improve cotton fiber quality.1-19.[12] Horsch R B, Fry J E, Hoffman N L, Eichholtz D, Rogers S .ReferencesG, Fraley R T. A simple and general method of transferringgenes into plants. Science, 1985, 227: 1229-1231.[1] Liu Jinyuan, Zhao Guangrong， Li Ji. Molecularengineering on quality improvement of cotton fiber. Acta[13] Higo K, Ugawa Y, Iwamoto M, Korenaga T. Plantcis- acting regulatory DNA elements (PLACE) database.Botanica Sinica, 2000, 42(10): 991-995. (in Chinese)Nucleic Acids Research, 1999, 27(1): 297-300.[2] Zhao Guangrong, Liu Jinyuan. Progress in studies oncotton fiber morphogenesis. Cotton Science, 2002, 14(2):[14] Terzaghi W B， Cashmore A R. Light-regulatedtranscription. Annu. Rev. Plant Physiol. Plant Mol. Biol,121-125. (in Chinese)1995, 46: 445-474.] John M E, Crow L J. Gene expression in cotton fiber:Cloning of the mRNAs. Proc. Natl. Acad. Sci USA, 1992,[15] Le Gourrierec J, Li Y F, Zhou D X. Transcriptional89: 5769-5773.activation by Arabidopsis GT-1 may be through interactionwith TFIIA-TBP-TATA complex. Plant J., 1999, 18(6):[4]TanH,CreechRG,JenkinsJN,ChangYF,MaDP.663-668.Cloning and expression analysis of two cotton (Gossypium[16] Bate N, Twell D. Functional architecture of a late pollenhirsutum L.) genes encoding cell wall proline- rich proteins.DNA Seq., 2001, 12 (5-6): 367-380.promoter: Pollen-specific transcription is developmentally[5] Zhao G R, Liu J Y. Isolation of a cotton RGP gene: Aactivator elements. Plant Mol. Biol, 1998, 37(5): 859-869.homology of reversibly glycosylated polypeptide highlyexpressed during fiber development. Biochem. Biophys.[17] Mitsuda N, Takeyasu K, Sato M H. Pollen-specificActa, 2002, 1574: 370-374.regulation of vacuolar H+- PPase expression by multiplecis-acting elements. Plant Mol. Biol, 2001, 46: 185-192.[6] Kim HJ, Williams M Y, Triplett B A. A novel expressionassay system for fiber-specific promoters in developing[18] Gubler F， Kalla R，Roberts J K, Jacobsen J V.Gibebrllin-regulated expression of a myb gene in barleycotton fibers. Plant Molecular Biology Reporter, 2002, 20:-18.aleurone cells: Evidence for myb transactivation of ahigh- pI alpha amylase gene promoter. Plant Cell, 1995,[7] HsuC Y, Creech R G, Jenkins J N, Ma D P. Analysis of7(11): 1879- 1891.promoter activity of cotton lipid transfer protein gene LPT6in transgenic tobacco plants. Plant Sci, 1999, 143: 63-70.[19]VanderMeerIM,BrouwerM,SpeltCE,MolJNM,Stuitje A R. The TACPyAT repeats in the chalcone[8] Rinehart J A, Petersen M W, John M E. Tssue- specificand developmental regulation of cottonFbL2Asynthase promoter of Petunia hybrida act as a dominantnegative cis-acting module in the control of organ- specificdemonstration of promoter activity in transgenic plants.expression. Plant J, 1992, 2: 525-535.Plant Physiol, 1996, 112(3): 1331-1341.中国煤化工MHCNMH G.