Expression and activity of inducible nitric oxide synthase and endothelial nitric oxide synthase cor

PO Box 2345, Beijing 100023, ChinaI Gastroenterol 2006 April 21; 12(15): 2375-238wig@wjgnet.come2006 The wJG Press. All rights reservedBASIC RESEARCHExpression and activity of inducible nitric oxide synthaseand endothelial nitric oxide synthase correlate with ethanol-induced liver injuryGuang-Jin Yuan, Xiao-Rong Zhou, Zuo-Jiong Gong, Pin Zhang, Xiao-Mei Sun, Shi-Hua ZhengGuang-Jin Yuan, Xiao-Rong Zhou, Zuo-Jiong Gong, Pin expression eNOs activity is reduced, but its mRNA exZhang, Xiao-Mei Sun, Shi-Hua Zheng, Department of pression is not affectedInfectious Diseases, Renmin Hospital of Wuhan University,Wuhan 430060, Hubei Province, China@2006 The WJG Press. All rights reserved.Correspondence to: Dr. Zuo-Jiong Gong, Department ofInfectious Diseases, Renmin Hospital of Wuhan University, Key words: Alcoholic liver disease; Inducible nitric ox-Wuhan430060,HubeiProvinceChinazjgong(@163.comTelephone:+86-27-88041919-8385ax:+86-27-8042292ide synthase; Endothelial nitric oxide synthase; NuclearReceived: 2005-09-1Accepted: 2005-10-26factor-KBYuan G], Zhou XR, Gong Z, Zhang P, Sun XM, Zheng SH.Expression and activity of inducible nitric oxide synthaseAbstractand endothelial nitric oxide synthase correlate with ethanol-induced liver injury. World J Gastroenterol 2006: 12(15AIM: To study the expression and activity of inducible 2375-2381nitric oxide synthase(iNOS) and endothelial nitric oxidesynthase(enos)inratswithethanol-inducedliverinjuryhttp://www.wjgnet.com/1007-9327/12/2375.aspand their relation with liver damage activation of nuclearfactor-kB(NF-KB)and tumor necrosis factor-a(TNF-aexpression in the liver.INTRODUCTIONMETHODS: Female Sprague-Dawley rats were givenfish oil(0.5 mL)along with ethanol or isocaloric dextrose Nitric oxide (NO)has been recognized as an importantdaily via gastrogavage for 4 or 6 wk. Liver injury was mediator of physiological and pathophysiologicalassessed using serum alanine aminotransferase(ALT) processes. It is produced by at least two isoforms ofctivity and pathological analysis. Liver malondialdehyde nitric oxide synthase (NOS)in the liver, such as eNOSwere determined. NF-KB p65, iNOS, eNOS and TNF-a constitutive isoform and plays an important roleneMDA), nitric oxide contents, iNOS and eNOS activity and INOS, eNOS is a Ca"-and calmodulin-dependdprotein or mRNA expression in the liver were detected vasorelaxation, whereas iNOS is not a constitutive enzymeby immunohistochemistry or reverse transcriptase-poly- and its expression may be induced by stimuli such asmerase chain reaction(RT-PCR)lipopolysaccharide or proin flammatory cytokinesRESULTS: Chronic ethanol gavage for 4 wk causeThe role of NO in alcohol-induced liver injury stillremains controversial. Nanji et aP reported that argininesteatosis, inflammation and necrosis in the liver, and a substrate for NO, can significantly attenuate ethanolelevated serum ALT activity. Prolonged ethanol ad- induced liver injury. Treatment with N-nitro-L-arginineministration (6 wk) enhanced the liver damage. These methyl ester(L-NAME), a nonselective NOS inhibitor,responses were accompanied with increased lipid peroxidation, NO contents, iNOS activity and reduced eNos enhances alcohol-induced liver injury in the Tsukamoto-ctivity. NF-KB p65, iNOs and TNF-a protein or mRNAFrench enteral rat modelA. However, iNoS knockout miceexpression were markedly induced after chronic etha- or wild-type mice treated with N-(3-aminomethyl) benzylnol gavage, whereas eNOS mRNA expression remained acetamidine(1400W), a highly selective iNOS inhibitorunchanged. The enhanced iNOS activity and expression are protected against liver damage caused by alcohol slwere positively correlated with the liver damage, espe-Uzun et alo showed that L-NAME might produce acially the necro-inflammation, activation of NF-KB, andethanelinduced liver damageTNF-a mRNA expression中国煤化工 quitous transcriptionfactoCNMHle in regulation ofCONCLUSION: iNOS expression and activity are in inflomposed of homo-duced in the liver after chronic ethanol exposure in rats, and hetero-dimers of five members of the rel family,which are correlated with the liver damage, especially including NF-KB1(p50), NF-KB2(P52),Rel A (p65), Relthe necroinflammation, activation of NF-kB and TNF-a B, and Rel c. the most prevalent activated form of Nf-www.wjgnet.comISSN 1007-9327 CN 14-1219/R World J Gastroenterol April 21, 2006 Volume 12 Number 15B is a heterodimer consisting of a p50 or a p52 subunit processed for light microscopy. This processing consistedand p65. NF-KB exists in cytoplasm in an inactive form of fixing the specimens in 10% formaldehyde for 12-24associated with regulatory proteins called IxB. After h, embedding them in paraffin, slicing sections of 5 umstimulation, it is translocated to the nuclei and bound to in thickness and staining the sections with hematoxylindecameric DNA sequences, and activates transcription of and eosin. Histological assessment was performed bytarget genes". NF-KB has been shown to be functionally a pathologist unaware of the study. The severity ofimportant for iNOS induction. In the present study, we liver pathology was assessed as follows": steatosis(thedisease, and examined the expression and activity of inos percentage of liver cells containing fat), 1+, <25% of cellsused fish oil plus ethanol gavage model of alcoholic liverontaining fat; 2+, 26%0-50% of cells containing far; 3+,and eNOS in the liver, and their relation with liver damage, 51%0-75% of cells containing fat; and 4+, >75% of cellsactivation of NF-KB and TNF-a expression.containing fat. Necrosis was evaluated as the number ofnecrotic foci/ mm and inflammation was scored as theMATERIALS AND METHODSnumber of in fammatory cells/ mmChemicals and reagentsSerum alanine aminotransferase assPolyclonal rabbit anti-iNOS and anti-NF-KB p65 were Blood samples were allowed to clot, and the sera were iso-obtained from Santa Cruz Biotechnology, Inc. Biotinylated lated by centrifugation at 1000 r/min for 10 min and keptgoat-anti-rabbit IgG was purchased from Beijing at-20C before determination. Enzymatic activity of ala-Zhongshan Reagent Corp. TRIzol reagent was purchased nine aminotransferase(ALT) was measured using a comfrom Invitrogen. DL2000 DNA ladder marker was from mercial kit by an RA1000 automatic biochemical analyzerTaKaRa Biotech Co, Ltd M-MLV reverse transcriptase apanand its buffer, deoxyribonucleotide(dNTP, 10 mmol/L)and oligo(dT)is primer were from Promega Corp. Taq Liver MDA contents and NOS activity assa homogenizedDNA polymerase and its buffer, rRNasin ribonuclease Liver samples were thawed, weighed andnhibitor was from Biostar. Polymerase chain reaction 1:9 w: v in 0.9% saline. Then the homogenates were cen-(PCR) Primers for eNOS, INOS, TNF-a and GAPDH, trifuged at 3 000 r/ min for 10 min at 4C and the superwere synthesized by Sai-Bai-Sheng Biocompany( Shanghai, natant was taken for the assays of MDA contents,China). Malondialdehyde(MDA), nitric oxide(No) activity and total proteinand nitric oxide synthase(NOS) activity assay kits werethe thiobarbituric acid-purchased from Nanjing Jiancheng Bioengineering Co Ltd, reactive substances(TBARS)levels spectrophotometricallyChinaat 532 nm. Results were expressed as nmol. mg proteinOS catalyzed the formation of NO and L-citrullineAnimal modelfrom L-arginine and molccular oxygen, and NO reactedFemale Spraguc-Dawley rats weighing 200-250 g, were with a nucleophile to generate color compounds. Theobtained from the Experimental Animal Center of Wu- absorbance at 530 nm NOS activity was calculated andhan University. After acclimation for 6-7 d, animals were expressed as U/mg protein. One unit of NOS activityrandomly divided into 4-wk dextrose group (n=5), 6-wk was defined as the production of 1 nmol nitric oxide perdextrose group(n=5),4-wk ethanol group (=8), and second per mg tissue protein. Total NOS activity was mea-6-wk ethanol group (n=8). Rats were given 0.5 mL fish oil sured as follows: 10% tissue homogenate(100 uL)wasalong with ethanol or isocaloric dextrose intragastrically incubated with 200 uL substrate buffer, 10 HL reaction ac-by gavage. The initial dose of ethanol was 6 g/kg per day celerator and 100 uL color development reagent at 37C(solutions maximally containing 56 mL/100 mL alcohol), for 15 min after mixing. Then 100 uL clearing reagent andand the dose was progressively increased during wk 1 to 2 mL stop solution were added, mixed and absorbancesa maintenance dose of 8 g/kg per day that was continued were read at 530 nm. For measuring iNOS activity, anfor another 3 or 5 wk. All rats had free access to regular inhibitor was added before incubation according to thestandard rat chow throughout the experiment. The animals manufacturer's instructionswere weighed three times per wk. At the end of the experiTotal protein concentration was determined using thement, the animals were anaesthetized with urethane(20%, Coomassie blue method with bovine serum albumin as1.0 g/kg) and sacrificed by bleeding from femoral arteries standardand veins. Blood samples were collected Immediately afterexsanguination, the livers were harvested. Small portions Liver NO assayof the liver were kept at -70C for reverse transcriptase- Liver samples were thawed, weighed and homogenizedpolymerase chain reaction(RT-PCR)analysis, whereas 1: 9 w: v in 0.9%saline. The homogenates were then cen-ortion was separated and immersed in 10% buf- trifuged at 1 000 r/min for 5 min at 4 C, the supernatantfered formalin solution for histological and immunohisto- waschemical examination. All animals were given humane care中国煤化工 rotein detcrminationin compliance with the institutional guidelines.CNMHGs NO2) and the stableend products of NO metabolism. In the procedure nitratePathological evaluationwas enzymatically converted into nitrite by the enLiver specimens, 1.0 X0.5 cm X0.3 cm in size, were nitrate reductase, followed by quantitation of nitrite using万方数wwww据Yuan Get a/ iNOS and eNOS in ethanol-induced liver injury2377Table 1 PCR primers used for iNOS, eNOS, TNF-a and GAPDHTTCTTTGCTTCTGTGCTAATGOGITGTTGCTGAACTTCCAATCGTeNOS TGGGCAGCATCACCTAOGATAGGAACCACTCCTTTTGATCGAGTTATTNF-a GCCAATGGCATGGATCTCAAAGCAGAGCAATGACTCCAAAGTGAPDH TCCCTCAAGATTGTCAGCAAAGATCCACAACGGATACATTGriess reagent at the absorbance of 550 nm as previously L, each), 2.0 units of Taq DNA polymerase and 1 uL ofdescribed!.Results were expressed as umol/g proteinCDNA in a total volume of 50 uL. Thirty-five cycles ofamplification were performed with initial incubation atImmunohistochemical detection of iNOS and NF-kB p65 in 94C for 3 min and a final extension at 72C for 7 min,livereach cycle consisted of denaturation at 94C for 45 s, an-Five um thick sections were prepared from paraffinnealing a54℃for45 s and extension at72℃for1minembedded tissues. After deparaffinization, endogenous To ensure the use of equal amounts of CDNA from eachperoxidase was quenched with 3% H2 Oz in deionised wa- group samples in PCR, the aliquots of the reverse tran-ter for 5-10 min. Nonspecific binding sites were blocked scription products were used in PCR with the primers forby incubating the sections in 10% normal rabbit serum for house-keeping gene GAPDH. The quantities of cDNA10-15 min. The sections were then incubated with poly- producing equal amounts of GAPDH-PCR-productclonal rabbit anti-iNOS(dilution 1: 25)or anti-NF-kB p65 were used in PCR with the primers for iNOS, eNOS and(dilution 1: 100) overnight at 4C, followed by incubation TNF-a. Following RT-PCR, 5 AL samples of amplifiedwith biotinylated goat-anti-rabbit IgG at room temperature products was resolved by electrophoresis on 2% agarosefor 10-15 min. After 3x3 min PBS rinses, the horseradish- gel and stained with ethidium bromide. The level of eachperoxidase-conjugated streptavidin solution was added PCR product was semi-quantitatively evaluated using a diand incubated at room temperature for 10-15 min. The gital camera and an image analysis system (Vilber Lourmat,antibody binding sites were visualized by incubation with a France), and normalized to GAPDHdiaminobenzidine-H2 Oz solution. The sections incubatedwith PBS instead of the primary antibody were used as Statistical analysisnegative controls. Brown-yellow granules in cytoplasm or Results were presented as mean +SD unless otherwisenuclei were recognized as positive staining for iNOS or indicated. Differences between groups were analyzed usingNF-kB p65 respectively. NF-kB immunoreactivity was ex- analysis of variance with post boc analysis using LSD test.pressed as the number of positive cells /high-power field(x The correlation was analyzed with Spearman's correlation400coefficients. P<0.05 was considered statistically significantRT-PCR analysis of iNoS, eNOS and TNF-a mRNARESULTSexpression in liverTotal RNa was isolated from approximatively 50-100 In each of the four groups, the rats increased their weightmg snap-frozen liver tissue using the TRizol protocolat a constant rate. There was no difference in weias suggested by the supplier. Following precipitation, among the groups.the RNa was resuspended in RNAse-free buffer, theconcentration was assayed by measuring ultra-violet light Pathological changes and serum aminotransferase activitysorbance at 260 nm and purity was estimated from the The animals given fish oil plus dextrose developed slightratiosteatosis in the liver. but no obvious inflammation orsynengle-stranded complementary DNA (CDNA)was necrosis was observed(Figure 1A).However, chronicsynthesized from the total RNA using the following ethanol gavage for 4 wk caused steatosis, minimal tomethod. In brief, 2 ug RNA was preincubated with 0.5 ug mild inflammation and necrosis in the liver(Figure 1B)oligo(dT)us primer and diethylpyrocarbonate(DEPC)-treat- Prolonged ethanol administration(6 wk) enhanced the liverd water was added to a total volume of 15 uL at 70 C for damage. Pronounced macrovesicular and microvesicular5 min, then rapidly chilled on ice. To the annealed primer/ steatosis as well as spotty necrosis and mild inflammationtemplate 5 HL M-MLV 5Xreaction buffer, 1.25 HL dNTP were observed(Figure 1C, Table 2)(10 mmol/L, cach), 25 units of rRNasin ribonuclease in-Consistent with the histological changes, serum ALThibitor, 200 units of M-MLV RT and DEPC-treated water levels, an index of liver cell injury, were significantlywere added to a final volume of 25 uL, Thereaction wasIncreas中国煤化工I further increased inincubated at 42 C for 60 min and terminated by placing it 6-wkith dextrose groupson ice after deactivation at 85C for 5 min. The resulting TableCNMHGcDNA was used as a template for subsequent PCR.Themixture contained 5 uL of 10XTaq buffer, Liver MDA and NO contents1 HL of(10 mmol/L, each), 1 uL of gene specific Liver contents of MDA, a marker of lipid peroxidation,primers1, sense and anti-sense primers, 25pmol/ were significantly increased after 4 wk ethanol gavage2378 ISSN 1007-9327 CN 14-1219/R World J Gastroenterol April 21, 2006 Volume 12 Number 15Figure 1 Representative pathologic changes in 4-wk dextrose group(A), 4-wk ethanol group(B), and 6-wk ethanol group(C). Original magnification, x200Table 2 Pathological scores, serum ALT levels and liver MDA contents in differentexperimental groups(mean+ SD)atty liver NecroinRammadion ALT(U/L) MDA(nmol/mg protein)4wk ethanolse02±0.25434±305483±0.7021±064161±2.1se06±0351.6±1.525.36±03129±064124.1±728938±0.39°P<0.05 Ds 4-wk dextrose group: 'P<0.05 us 6-wk dextrose groupTable 3 Liver No contents, iNoS and enos activity in differentexperimental groups(mean+ SD)No (mol/g protein) INOS (U/mg protein) eNoS(U/mg protein048±0036-wk dextrose087±0070.58±004184±0.12b070±0043±005b"p<0.05 us 4-wk dextrose group;P<0.05 us 6-wk dextrose groupcompared with dextrose groups. Prolonged ethanol but only nuclear staining was considered positive. Thereexposure(6 wk) led to a further increase in MDA contents was no positive staining in two dextrose groups, whereaschronic ethanol administration, remarkableLevels of NO in the liver of two dextrose groups were enhancement in the positive staining was observed (Figures0.75+0.14 and 0.87+0.07 umol/g protein, respectively. 2A and 2B). The number of positive cells in 4-wk andChronic ethanol gavage-induced NO level was two-fold 6-wk ethanol groups was 8.0+1.1 and 10.0+1.9/highhigher in 4-wk ethanol group and further higher in 6-wk power field, respectively(Figure 2C). The NF-KB P65ethanol group(Table 3).positive cells were primarily Kupffer cells and hepatocytesLiver NOS activityiNOS, eNOS and TNFox expression in liverThe isoforms of NOs present in the liver were mainly Only faint immunoreactive staining of iNOS was detectedeNOS and iNOS as previously reported. The amount of in the liver from dextrose groups(Figure 3A). However,total NOS activity minus iNOS activity might represent intense staining of iNOS was observed in 4-wk cthanolthe activity of eNOS. Chronic fish oil plus ethanol group(Figure 3B), and more intense staining was found ingavage led to a marked elevation in iNOS activity with 6-wk ethanol group(Figure 30). The staining was mainlyfurther elevation in 6-wk ethanol group compared with preh severelv damaged and perivascular areas.4-wk ethanol group. In contrast, the eNOS activity was中国煤化工 ctable in the liver ofsignificantly reduced compared with dextrose groups ( Table dextethanol gavage (4 wk)INOCNMHd Prolonged ethanolgavage(6 wk) was associated with more intense bandsExpression of NF-KB p65 in liver(Figure 4). In dextrose groups only faint bands for TNF-NF-KB p65 staining was present in cytoplasm and nuclei, were detected. After chronic ethanol gatYuan G]et a/ iNOs and eNOS in ethanol-induced liver injury2379A.8O6-a●95A4-wk4-wkDextrose Ethanol Dextrose EthanolFigure 2 Expression of NF-KB p65 in 6-wk dextrose group(A), 6-wk ethanol group(B)and the number of positive cells in high-power fields(C). P<0.01 vs dextrose groupFigure 3 Immunohistochemical detection of iNOS in 6-wk dextrose group(A), 4-wk ethanol group(B), and 6-wk ethanol group(C). Original magnification, x200expression pattern of iNOS was also observed in TNF-a liver injury. The rats developed pathological changes inmRNA expression( Figure 4)the liver after 4 or 6 wk, such as steatosis, spotty necrosn contrast, there was no significant change in cNOS and inflammation, all of which resemble alterations foundmRNA expression between dextrose and ethanol groups in clinical alcoholic liver disease. This chronic gavage of(Figure 4)alcohol in rats is a simple experimental model that mimicskey aspects of alcoholic liver disease in humans, and isRelationship between liver iNOS activity, expression and uscful for exploring the mechanism and treatment ofother parametersalcoholic liver diseaseCorrelation analysis showed that liver iNOS activity wasNO is an important biological mediator and has beenpositively correlated with the severity of liver damage shown to be involved in diverse physiological as well as(steatosis, necroinflammation)(r=0.71 and 0.93pathological processes. In our study, chronic ethanolrespectively, P<0.05), especially the necroinflammation. gavage led to a significant elevation of liver NO contentsiNOS expression was only detected in rats with liver compared to dextrose groups. NO is generated by NOSdamage,activation of NF-KB and intense TNF-a mRNA We assayed the activity of total NOS and iNOS in liverexpression. The intensity of the former paralleled that of Because the main isoforms of NOS in the liver are eNOSthe latterand iNOS 2, the amount of total NoS activity minusNOS activity may represent the activity of eNOS. OurDISCUSSIONstudy showed that iNOS activity was significantly elevatedafter chronic ethanol consumption in rats, whereas eNOSIt has been reported that dietary fatty acids play an activity was markedly reduced as compared with dextroseimportant role in the pathogenesis of alcoholic liver groups. Accompanying the enhanced activity, iNOSdisease.Polyunsaturated fatty acids enriched in expressionhu immunohistochemistry and RTfish oil promote alcoholic liver injury and pathological PCR中国煤化工 increased in ethanolchanges occur only in rats fed with ethanol containing groupCNMHHowever, the eNOStween these groupsmore severe and develops rapidly in women than in The results suggest that the elevated NO release in themen". Our study employed female rats and used fish oil liver is attributable to the enhanced activity and expressionplus ethanol gavage to make an animal model of alcoholic of iNOS. Relationship analysis showed that enhancedww.wignet.com2380ISSN 1007-9327 CN 14-1219/R World J Gastroenterol April 21, 2006 Volume 12 Number 15may be dependent on the isoforms of NOSOxidant stress has been reported to play a role inthe pathogenthis study, liver contents of MDA, a marker of lipidperoxidation, were significantly elevated in the ethanolgroups as compared with dextrose groups. Oxidant stresscan result in degradation of the cytoplasmic NF-KBinhibitor,IKB, allowing translocation of NF-KB to nucleiOur study showed that chronic ethanol gavage significantlyenhanced the expression of active NF-KB in the liver,as evidenced by the increased number of NF-KB p65positively stained (in nuclei) cells. Furthermore, TNF-amRNA expression in the liver was markedly increasedThese results are consistent with the report of Nanjiet alb, who showed that NF-KB is activated duringalcoholic liver disease in the presence of pro-inAammatorystimuli, resulting in increased expression of proinflammatory cytokines and chemokines. In our study,correlation analysis showed that iNOS expressionwas positively associated with NF-KB p65 expressionsuggesting that increased iNOS expression may becaused by the activation of NF-KB. Activated NF-KBa transcription factor, may bind to the specific DNAsequence of iNOS to promote its expressionIn conclusion, iNOS expression and activity induced inethanol-induced liver injury are responsible for the elevatedNO production. The induction of iNOS is associated withliver damage, especially necroinflammation, activation ofNF-KB and elevated TNF-a mRNA expression in the liverREFERENCES1 Chen T, Zamora R, Zuckerbraun b, Billiar TR Role of nitricoxide in liver injury. Curr Mol Med 2003; 3: 519-5262 McNaughton L, Puttagunta L, Martinez-Cuesta MA,Kne-teman N, Mayers L, Moqbel R, Hamid Q, Radomski MW.Distribution of nitric oxide synthase in normal and cirrhotichuman liver. Proc Natl Acad Sci USA 2002 99: 17161-171663 Nanji AA, Jokelainen K, Lau GK, Rahemtulla A, Tipoe GLPolavarapu R, Lalani EN. Arginine reverses ethanol-inducedinflammatory and fibrotic changes in liver despite continuedethanol administration. Pharmacol Exp Ther 2001; 299: 832-839Figure 4 RT-PCR analysis of mRNAs for iNOS, eNOS and TNF-a in the liver. ANanji AA, Greenberg SS, Tahan SR, Fogt F, Loscalzo J, Sadrzarepresentative bands for iNoS, TNF-a, NOS and GAPDH transcripts(lane 1: 6-wkdeh SM, Xie J, Stamler JS. Nitric oxide production in experidextrose group, lane 2: 4-wk dextrose group, lane 3: 6-wk ethanol group, lanmental alcoholic liver disease in the rat: role in protection from4-wk ethanol group): B: normalized densitometric ratios of iNOS, TNF-a andinjury. Gastroenterology 1995: 109: 899.907eNOS transcripts to GAPDH. P<0.01 vs dextrose group5 McKim SE, Gabele E, Isayama F, Lambert )C, Tucker LM,Wheeler MD, Connor HD, Mason RP, Doll MA, Hein Dw,Ar-teel GE. Inducible nitric oxide synthase is required in alcohol-induced liver injury: studies with knockout mice. Gastroenter-NoS activity and expression were associated with theology2003125:18341844severity of liver damage, especially the necroinflammation6 Uzun H, Simsek G, Aydin S, Unal E, Karter Y, Yelmen NKthat iNOS contributes to alcohol-induced liverVehid S, Curgunlu A, Kaya S Potential effects of L-NAME onalcohol-induced oxidative stress. World Gastroenterol 2005: 11injury. It was reported that iNOS knockout mice or wild00-604type mice treated with 1400W, a highly selective INOS 7 Tak PP, Firestein GS NF-kappaB: a key role in inflammatoryinhibitor, are protected against alcohol-induced liverdiseases. Clin Invest 2001; 107: 7-11injury 5!. In contrast with iNOS, eNoS activity is reduced 8 Taylor BS, Alarcon LH, Billiar TR Inducible nitric oxide syn-after treatment with ethanol. A recent report showed中国煤化工that chronic alcohol intake attenuates hepatic enoS 9GL, Rahemtulla A, Thomasactivity by increasing the expression of the inhibitoryCN Gents alcohol-induced liverprotein caveolin-1 and enhancing its binding to eNOSdisease in rats by inhibiting tssion of NF-kappa B-de-Treatment with L-NAME, the stronger eNOS inhibitor,pendent genes. Am/ Physiolest Liver Physio! 2003 284exacerbates alcohol-induced liver injury. These factsC321G32710 Tarpey MM, Wink DA, Grisham MB. Methods for detectionsuggest that the role of NO in ethanol-induced liver injuryof reactive metabolites of oxygen and nitrogen: in vitro andYuan G]et al iNOS and eNOS in ethanol-induced liver injury2381in vivo considerations. Am J Physiol Regul Integr Comp Physiol 15 Wang X, Abdel-Rahman AA. Effect of chronic ethanol admin-2004;286:R431-R444stration on hepatic eNOS activity and its association with11 Nanji AA. Role of different dietary fatty acids in the patho-iveolin-1 and calmodulin in female rats. Am J Physiol gastro34: 2,s of experimental alcoholic liver disease. Alcohol 2004:intest Liver Physiol 2005: 289: G579-G58516 Arteel GE Oxidants and antioxidants in alcohol-induced liver12 Purohit V, Russo D, Coates PM. Role of fatty liver, dietarydisease. Gastroenterology 2003: 124: 778-790fatty acid supplements, and obesity in the progression of alco- 17 Asehnoune K, Strassheim D, Mitra S, Kim JY, Abraham E.holic liver disease: introduction and summary of the sympo-Involvement of reactive oxygen species in Toll-like receptorsium, Alcohol 2004: 34: 3-84-dependent activation of NF-kappa B. J Immunol 2004;13 Nanji AA, Zhao S, Sadrzadeh SM, Dannenberg A, Tahan SR,Waxman DJ Markedly enhanced cytochrome P450 2E1 in- 18 Nanji AA, Jokelainen K, Rahemtulla A, Miao L, Fogt F, Matsu-duction and lipid peroxidation is associated withmoto H, Tahan SR, Su GL. Activation of nuclear factor kappajury in fish oil-ethanol-fed rats. Alcohol Clin Exp Res 1994; 18:B and cytokine imbalance in experimental alcoholic liver dis1280-1285ease in the rat. Hepatology 1999: 30: 934-94314 Ashley MJ, Olin ]s, le Riche WH, Kormaczewski A, Schmidt W, 19 Spink J, Cohen J, Evans TJ. The cytokine responsive vascularRankin JG. Morbidity in alcoholics. Evidence for acceleratedsmooth muscle cell enhancer of inducible nitric oxide syn-development of physical disease in women. Arch Intern Medhase. Activation by nuclear factor-kappa B. J Biol Chem 1995:1977;137:883-887Editor Wang L- Editor Wang XL E- Editor Ma Wh中国煤化工CNMHG