通过抑制酿酒酵母乙醇发酵中的甘油产率提高乙醇产率

Chinese Joumal of Chemical Engineering, 16(4)620--625(2008)Improve ethanol Yield Through Minimizing glycerol Yield inEthanol Fermentation of Saccharomyces cerevisiaeZHANG Aili(张爱利) and CHEN Xun(陈洶)School of Chemical Engineering and Technology, Tianjin University. Tianjin 300072, ChinaAbstract In ethanol fermentation of Saccharomyces cerevisiae (S. cerevisiae), glycerol is one of the mainby-products. The purpose of this investigation was to increase ethanol yield through minimizing glycerol yieldn which FPS/ encoding a channel protein that mediates glycerol export and gPD2 encoding oneglycerol-3-phosphate dehydrogenase were knocked-out using one-step gene replacement. GLTI and GLNI that en-code glutamate synthase and glutamine synthetase, respectively, werement in psl△gpd2△ mutant. The fermentation properties of ZAL69sl△:EU2gpd2△:URA3)andupsLND)under miared with those of wild type(DC124) Consumption of glucose, yield of ethanol, yield of glycerol, acetic acid, andpyruvic acid were monitored. Compared with wild type, the ethanol yield of ZAL69 and ZAL808 were improved13. 17%and 6.66 %, respectively, whereas glycerol yield decreased by 37. 4 and 41.7 %. Meanwhile, aceticacid yield and pyruvic acid yield decreased dramatically compared to wild type. Our results indicate that FPS/ andGPD2 deletion of S. cerevisiae resulted in reduced glycerol yield and increased ethanol yield, but simultaneous over-expression of GLTI and GLNI in fps lAgpd2A mutant did not have a higher ethanol yield than fps / Agpd2A mutant.Keywords Saccharomyces cerevisiae, ethanol yield, glycerol yield, gene knock-out, gene over-express, FPSIGPD2, GLNI GLTI1 INTRODUCTIONGPPI is stimulated under anaerobicns[2-6Glycerol-3-Phosphate dehydrogenaseot glycIn ethanol fermentation of Saccharomyces cereerol phosphatase, is rate-limiting forvisiae(S cerevisiae), in addition to biomass and cartion in S cerevisiae (71bon dioxide, a number of byproducts are produced,Ammonium is often used as nitrogen source insuch as glycerol and organic acids (e.g, acetic acid industrial fermentations of S. cerevisand pyruvic acid, succinic acid). Approximately 5% across the membrane into the cytoplasm, ammoniumcarbon source is converted into glycerol in ethanols assimilated into glutamate by reaction withfermentation. Eliminating formation of glycerol can a-oxoglutarate This consists of two coupled reactionsbe used to increase ethanol yield of S. cerevisiae catalyzed by glutamate synthase(GOGAT)(Reactionwithout increasing the overall cost of carbon source. I), encoded by GLTI, and glutamine synthetase(GS)Fig. 1 presents important pathways of glycerol and (Reaction 2), encoded by GLNI. The expression andethanol metabolism in S cerevisiaeregulation of glutamate synthase (GoGAT) have beenGlycerol formation has two roles in the fermerreportedtation of S. cerevisiae [1]. Under anaerobic fermenta-a-oxoglutarate glutamine +NADH-tions when the respiratory chain is not functioning, netlutamate +NADformation of NADH produced during synthesis ofglycerol in order to avoid a serious imbue ormation of glutamate +NH4+ATP-gutamine ADP + Pibiomass and organic acids, i.e., acetic acid, and pyruvic acid, must be reoxidized to nad balance in theNAD/NADH ratio. Synthesis of I mol glycerol froma-oxoglutarate+NH4+NADH+ATP→→glucose leads to reoxidation of 1 mol NADH. Fur-thermore, during growth under osmotic stress condiglutamate NAD+ ADP + Pitions, glycerol is formed and accumulated inside theBy over-expressing both GLTI and GLNI it shouldcell where it works as an efficient osmolyte that pro- be possible to convert NADH to NAD in the synthe-tects the cell against lysis.sis of glutamate from ammonium and 2-oxoglutarateThe yield of glycerol is controlled by its biosyn- resulting in a reduced surplus formation of NADH andthetic pathway as well as by regulated transmembrane thus, a lower glycerol production. The geneticallycolytic intermediate dihydroxyacetone phosphate in quirement for synthesis of ATP because Reaction 2two steps catalyzed by NAD-dependent glycerol-3- requires ATP. Presumably the larger drain of ATP willphosphate dehydrogenase and glycerol-3-phosphate be compensated by a higher ethanol production[8].phosphatase. Both enzymes are encoded by two simibeen used for construction oflar isogenes, GPDI plus GPD2 and GPPI plus GPP2, high中国煤化工 violae, for examively. Expression of GPDIiPPduced by high osmolarity, whereas that of GPDZ and glycerCNMH Ge resulting higherReceived 2007-08-13, accepted 2008-03-26supported by the National High Technology Research and Development Program of China(2002AA647040)Towhomcorrespondenceshouldbeaddressed.E-mail:chenxun@tju.edu.cnChin J. Chem Eng, Vol. 16, No. 4, August 200621mass部fructose-1. 6BPbiomass eglyceraldenhvde- 3P+ dihydroxyacetone-PNADH GPDIGPD212NADGUT2phosphoglyceratebiomass +3-phosphoglycerateFPS/2-phosphoglyceratephosphNADH NADNADHTCAFigure 1 Important pathways of glycerol and ethanol metabolism in S cerevisiaeimportant enzyme: I--hexokinase(glucokinase); 2- phosphoglucose isomerase: 3-phasphofructokinase 4--aldolase5-triose phosphate isomerase: 6--NAD-dependent glycerol-3-phosphate dehydrogenase; 7--glycerol-3-phosphatase8-glycerolaldehyd-3-phosphate dehydrogenase; 9- phosphoglycerate kinase; I0--phosphoglycerate mutase: 11enolase: 12- pyruvate kinase; 13- pyruvate decarboxylase; 14--alcohol dehydrogenase: 15--aldehyde dehydrogenase16-glycerol kinase: 17--FAD-dependent glycerol-3-phosphate dehydrogenasethanol yield [9-11], deletion of FPSI to increase 2.2 Plasmids and strains constructionsethanol yield [12], and simultaneous overexpression ofGLTI and GLNI resulting in higher ethanol yield [8]he primers and plasmids used in this study wereBut there have been no reports about the applications described in Table 2 and Table 3, respectivelyof deletion of both fpsi and gPd or simultaneousoverexpression of GLT/ and GLNI in fps/△gpd2△mutant. Hence, the purpose of this study was to inves2.3 Deletion of GPD2tigate whether deletion of both FPS/ and GPD2 orsimultaneous overexpression of GLTI and GLNI infpslAgpdza mutant would result in reduced glycerol upstream of the atG start codon of GPD2 at the 5yield and higher ethanol yield.end and 20 nucleotides of the Y Eplac195 at the 3 endand KGPD2-D containing nucleotides 1363 to 1324 of2 MATERIALS AND METHODSthe complementary strand downstream of the ATGstart codon of GPD2 at the 5 end and 20bp nucleo-2. 1 Yeast strains and mediatides of the complementary strand of the YEplac195 atthe 3 end, were used to clone a 1.36kb fragment con-The Saccharomyces cerevisiae strains used in this taining the open reading frame of URA3 by PCR withstudy were all isogonics to DC124 as described in prod煤化工 eThe strains of S. cerevisiae cells were routinefoCNMHSC minus uracilof gPD was veriyeast extract supplemented with 2% glucose as carbon fied by PCr analysis and the PCR products were disource(YPD). Selective media SC (13)minus leucine gested with EcoR 1. For this purpose, primersor uracil were used for selection of transformants CGPD2-U containing restriction enzyme site for Xba Icontaining LEUZ or URA3 selective marker.and BamH I in front of nucleotides 48 to 467622Chin J Chem Eng, Vol 16, No 4, August 2008Tablei Strains used in this studyDC12Mata leua ura3 trpI his3 ade8 can/M. wigler(isogenic. to SPl)Cold Spring Harbor, NY, USA)Mata leu2 ura3 trpI his3 ade8 canl pslA: LEU2Zhang et al. [12]ZAL69Mata leu ura3 trp/ his3 ade& canI psl4: LEU2 gp24: URAZAL808Mata leua ura3 trpI his 3 ade& canI fpslA: LEU2 gpd. URA3 PpGKI-GLTI PPGKT-GLNIthis workTable 2 Primers used in this studyPrimer nameKGPD2-U5CTCTTTCCCTTTCCTTTTCCTTCGCTCCCCTTCCTTATCAGTAGTCTAGTACTCCTGTG3KGPD2-D5'GCAACAGGAAAGATCAGAGGGGGAGGGGGGGGGAGAGTGTGAAAAGTGCCACCTGACGTC3CGPD2-U 5"TCTAGAGGATCCATAGCCATCATGCAAGCGTG3'(Xba I and BamH D)CGPD2-D5TAGCGCTCTTATCTCAGTGG3GitI-U5'GGGCCCGTCGACATGCCAGTGTTGAAATCAGA3(SaiD)Gltl-DCTGCAGTTTTAGTATCGACCATTTCA3'(Pst D)Gitlprom U 5'GGGCCCGGTACCTTTCTGAGCA CTGTCAGGAG3(Kpn DGitlprom. D5'GGGCCCGGATCCTGATTTCAACAC TGGCATGC3'(BamH DPGKI pro.-U 5'GGGCCCGGATCCAGGCATTTGCAAGAATTACTC3(BamHI)PGKI prom- D 5'GGGCCCGTCGACTGTTTTATATTTGTTGTAAAAAGTAG3'(Sal I)GinI PU5'GGGCCCGAGCTCGACCCATTTTTCTCAGCGCC3'(Sac I)GInI P-D5'GGGCCCAGATCTTCGATGCTTG CTTCAGCCAT3(Bgl Il)GIn1-U5'GGGCCCGTCGACATGGCTGAAGCAAGCATCGA3(SalD)GInI-D5'GGGCCCCTGCAGATATACAACACAGCG TCGCT3'(Pst DTable 3 Plasmids used in this studytruncation. Primer Gltlprom -U containing restrictionenzyme site for Kpn I in front of nucleotides 920 toPlasmids nameDescription911 upstream of the ATG start codon of GLT1, andAmp, URAGietzet al 1141Gltlprom. -D containing restriction enzyme site forAmp, URA3Gietz et al. [14]BamH I in front of nucleotides of the complementaryYlplac21l-P-GLNIstrand from18bp downstream of the atG start codonto 2bp upstream of the AtG start codon of GLTl, wereYlplac211-P-GLTIAmp, URA3used to clone parts of the promoter sequence of GLTIby PCR with the Pyrobest dNa polymerase (tARARA). The fragment was digested with Kpn I andBamH I, and ligated into the Kpn I and BamH I di-upstream of the ATG start codon of GPD2gestion sites of the plasmid Ylplac211-GLTI trunca-CGPD2-D containing nucleotides 1693 to 1674 oftion, resulting in the plasmid Ylplac211-GLTIcomplementary strand downstream of the ATGtruncation-GLTI promoter. PGKI prom.-U, contain-codon of GPD were useding restriction enzyme site for BamH I in front of nu-cleotides 721 to 701 upstream of the start codon of2.4 Overexpression of GLTIPGKl, and PGKI prom -D containing restriction en-zyme site for Sal I in front of nucleotides 26 to 1 ofthe complementary strand upstream of the start codonPrimer Gltl-U, containing restriction enzyme site of PGK1, were used to clone parts of the promoterfor Sal l in front of nucleotides I to 20 downstream of gene of PGK/ by PCR with the Pyrobest DNA polyrestriction enzyme site for Pst I in front of nucleotides sl se(TARARA). The fragment was digested with1390 to 1371 of the complementary strand down- Bam中国煤化 T into the sal i andstream of the start codon of GLTI, were used to clone GLTC MH Glasmid Ylplac211parts of the structure gene of GLTI by PCR with the p-GL71. ine plasmid was lineanzed by digestion withPyrobest DNA polymerase (TArArA). The fragment Bg! Il before transformation of yeast to SC minusas digested with Sal l and Pst I and ligated into the uracil medium plates. Correct insertion of the plasmidSal I and Pst I digestion sites of the plasmid into the gLTI locus on chromosome IV was verifiedYlplac2ll, resulting in the plasmid YIplac211-GLTI by PCR. For these purpose primers Gltl prom - U andChin J Chem Eng, Vol. 16, No 4, August 2008623Gltl-D were used Loop-out of the URA3 marker gene ing experiments. DNA fragments were purified usingby homologous recombination of the two direct GLT/ DNA recycle kits and PCR products were purifiedpromoter sequence was obtained by cultivating the using phenol deproteinization and ethanol precipitacorrect transformations on 5-FOA plates. Correct tion Restriction and modification enzymes were usedloop-out of the URA3 gene was verified by PCR, and according to the manufacturers'instruction. Yeastthe primers GitI prom -U and Gltl-D were usedtransformation was performed by the lithium acetatemethod. Escherichia coli Top10" was used for subclon2.5 Overexpression of GLNIing. All yeast strains were maintained at 4 C on YPDplates(containing 2%o peptone and 1% yeast extractsupplemented with 2% glucose as carbon source), andGlnI P-U containing restriction enzyme site for monthly prepared from a glycerol stock kept at-75oC.Sac I in front of nucleotides 1192 to 1173 upstream ofthe atG start codon of GLNI, and GlnlP-D contain- 2.7 fermentation conditionsing restriction enzyme site for Bgl Il in front of nu-cleotides 20 to I of the complementary strand down-stream of the atG start codon of gLNI. were used toMicroanaerobic cultivations were performed atclone parts of the promoter gene of GLNI by pCr 30C in the 250 ml unbaffled shake flasks keept at con-with the Pyrobest DNA polymerase(TARARA). The stant stiring speed of 100 r-min with 100 ml mediumfragment was digested with Sac I and Bg! ll, and (containing 2% peptone and 1% yeast extract supple-gated into the Sac I and Bg! II digestion sites of the mented with 6% glucose as carbon source).Initial bio-plasmid Ylplac2ll, resulting in the plasmidmass concentrations were set at OD660mm 1.0 after in-Ylplac211-GLNI promoter Primer GIn1-U containing oculation. Fermentation experiments were performed inrestriction enzyme site for Sal I in front of nucleotides triplicate and one representative experiment was shownI to 20 of downstream of the AtG start codon( +l bpto +20 bp)of GLNI, and Glnl-D containing restriction 2.8 Growth determinationenzyme site for Pst I in front of nucleotides 1400 to1381 of the complementary strand downstream of theatG start codon of GLNi, were used to clone theGrowth was followed by measuring the absorb-structure gene of GLNI by PCr with the Pyrobestance of the cultures at 660 nm in a bioquest CE25DNA polymerase(TARARA). The fragment was di- spectrophotometer(Progen Scientificgested with Sal I and Pst I, and ligated into the Sal I andPst i digestion sites of the plasmid Ylplac211-GLNI 2.9 Measurement of glucose, ethanol, glycerol,promoter, resulting in the plasmid Yiplac211-GLNI acetic acid, and pyruvic acid [16]ORF-GLNI promoter. PGKl prom -u containing restriction enzyme site for BamH I in front of nucleotides 721 to 701 upstream of the start codon of PGk1, min at 18000 g and the resulting supematants werefor Sal I in front of nucleotides 26 to I of the com- erol and glucose in the fermentation broth were deplementary strand upstream of the start codon of termined by HPLC using differential refractive indexPGKI, were used to clone parts of the promoter gene detector and Agilent ZORBAX carbohydrate columnof PGK/ by PCR with the Pyrobest DNA polymerase (Agilent Technologies Co Ltd, Beijing, China)elutedTARARA). The fragment was digested with Sall and by 75% acetonitrile with 1.0 ml-min The content ofBamHI, and ligated into the Sal I and BamH I diges- acetic acid and ethanol was determined using a gation sites of the plasmid Ylplac211-GLNI truncation, chromatograph(Shimadzu GC-2010)with a DB-WAXplasmid was linearized by digestion with Kpn I before Detector). The temperatures of inlet, oven, and detectransformation of yeast to SC minus uracil medium tor were kept at 200 C, 150 C and 200oC, respectivelyplates. Correct insertion of the plasmid into the glnThe content of pyruvic acid was determined using arlocus on chromosome XVI was verified by PCR. For RPig column(Waters, Milford, USA)eluted with 0.1these purposes primers GInl prom. U and Ginl-D molL -KH PO4(pH 3.0) at a flow rate of 0.6 ml-minwere used. Loop-out of the URA3 gene by homolo- at 30 C and a PDA(Photodiode Array)detector.sequence was obtained by cultivating the correcttransformations on 5-FOa plates. Correct loop-out of2.10 Determination of biomass concentrationthe URA3 gene was verified by PCR, and the primersGlnl prom - U and GInl-D were usedSamples (50, mn were centrifuged at 5000 g for10中国煤化工 water, and subse2.6 Growth conditions and experimental proce- weiglCNMHGIOCfOr 24 h andIncubation conditions were standardized at 30C3 RESULTSand 200 rmin orbital shaking. Standard techniqueswere applied as described in Ref. [15] for all gene clonThe fermentation properties of DC124(wild624Chin J. Chem. Eng, Vol 16, No 4, August 2008type), ZAL69, and ZAL808 were studied under mi. ZAL808 decreased 63. 4% and 68.8 %, respectively, asaerobic condition. As described in Fig. 2, the growth shown in Table 4. Pyruvic acid yield of ZAL669 andof ZaL808 is slower than DC124, but the growth of ZAL808 decreased 61. 1% and 54% as shown in Ta-ZAL69 fast than DC124. According to Table 4, the ble 4. However, glucose consumption profiles ofbiomass concentration of ZAL69 and ZaL808 did not ZAL69 mutant were similar compared with wild typehave great change compared to that of wild typeduring the growth phases according to Fig 3(c), but theglucose consumption profiles of ZAL808 lagged a little354 DISCUSSIONyield byFPSI deletion of s cerevisiae h15cently[12]. Other strategies had been used for con-struction of higher ethanol-producing yield strains of S.cerevisiae, for example, deletion of GPDI and GDP2that encode glycerol-3-phosphate dehydrogenase re-sult in higher ethanol yield (9-11), and simultaneousFigure 2 The biomass concentrations of strains DC124(4), over-expression of GLTI and GLNI result in higherZA1 69(O)and ZAL808(.)during exponential growth in ethanol yield (8]. But there have been no reports aboutthe applications of deletion of both FPSI and GPD2or simultaneous overexpression of GLT/ and GLNI infps lAgpd2A mutant. In this study, the effects of deleAs given in Fig. 3(a), ethanol yield of ZAL69 tion of both FPSI and GPD2 or simultaneousand ZAL808 did not shows great changes compared over-expression of GLTI and GLNI in ps Agpd2Awith DC124 during the first ten hours of the fermenta- mutant on the fermentation properties were investigatedtions, but increased sharply during the following hoursThe strain ZAL69 and ZAL808, along with wildAt the end point of the fermentations(24 h), ethanol type strain DC124, were characterized with respect toyield of ZAL69 and ZAL808 was improved by 13. 17% several parameters (Table 4). There was an increase inand 6.66%, respectively. As shown in Fig 3(b), glyc- the maximum specific growth rate from 0. 1276 h inerol yield of ZAL69 and ZaL808 decreased signifi- strain DC124 to 0. 1342 h in strain ZAL69, but thecantly during the fermentations, and at the end point maximum specific growth rate decreased to 0. 1253 hof the fermentations(24 h), glycerol yield of ZAL69 in strain ZAL808(Fig. 2, Table 4). This result wasand ZAL808 decreased by 37. 4% and 41.7further more supported by the fact that the consumppared with DC124tion of glucose in ZAL808 lagged a little compared toMeanwhile, acetic acid yield of ZAL69DC124 [Fig. 3( c)]. Similarly, the biomass content in825面208005time/hof the measured parameters during microanaerobic conditions of S. cerevisiae DC124(4), ZAL69ose as carbon and energy sourceTable 4 Comparison of growth and compound yields of DC124, ZAL69 and ZAL808 in batch fermentationsecific growth Biomass concentra- Glycerol yieldcetic acid vield Pyruvic acid yield中国煤化工0.1276066±00020.211±001CNMHG1.6287±002ZAL690.13420688±000210.132±001UU⊥UUJ05521±002ZAL808068±00180.123±0012.794±00050.029士0005075±002Note: Standard deviations were calculated for at least three independent fermentationsCalculated using measurements of optical density at 660 nm.Chin J Chem Eng, Vol 16, No 4, August 2008625all three strains remained virtually unchanged (Table 4). (psIA: LEU2 gPd2A: URA3). In summary, the presentTaken together, these results suggest that the cellular study has demonstrated the proposed concept to in-metabolic and biosynthetic pathways of ZAL69 and crease the ethanol yield by minimizing glycerol yieldZAL808 did not dramatically change comparedunder microaerobic conditions through deletion bothDC124FPSI and GPD2 of S cerevisiaeWhen FPSI and GPD2 which encode glycerolexport channel protein Fpslp and one of the twoenzymes for yeast NAD-dependent glycerol-3REFERENCESphosphate dehydrogenase Gpd2p of S. cerevisiae, re-spectively, were knocked-out, and glycerol biosyntheNevoigt, E, Stahl, U."Osmoregulation and glycerol metabolism insis and export were hampered. Glycerol yield mightthe yeast Saccharomyces cerevisiae", FEMS Microbiol, Rev, 21be decreased. Glycerol is one of the main by-products2 Albertyn, J. Hohmann, S. Thevelein, J M. Prior B A,"GPDIof ethanol fermentations and the decreased glycerolwhich encodes glycerol-3-phosphate dehydrogenase, is essential foryield might be useful for increasing ethanol yield Ourinvestigations verified this. The ethanol yield andexpression is regulated by the high-osmolarity glycerol responsed of Zal69 increased 9. 81% and de-pathway". Mol. Cell BioL, 6, 4135-4144(1994).3 Ansell, R, granath, K, Homann, S. Thevelein, J M, Adler, L,creased 37. 4%, respectively (Table 4). This suggestsThe two isoenzymes for yeast NAD-dependent glyc-that the substrate that would be used to form glycerolerol-3.phosphate dehydrogenase encoded by GPDI and GPDZ havehas been used to produce more ethanol by deletion ofdistinct roles in osmoadaptation and redox regulation", EMBO J.both FPSI and GDP2. Because the two isoenzymes16,21792187(1997for yeast NAD-dependent glycerol-3-phosphate de-Eriksson, P, Andre, L, Ansell. R, Blomberg, A Adler, L, "Cloninghydrogenase Gpdlp and Gpd2p can substitute eachand characterization of GPD2, a second gene encoding glycrol-3-phosphate dehydrogenase (NAD) in Saccharomyces cere-other, in the fps lAgpd2A mutants(Zal69) Gpdlp isae, and its comparison with GPDI". Mol Microbiol, 1 95-107active, and the cells have the ability to biosynthesissome glycerol to keep the redox balance and adapt to5 Martijn, R, Albertyn, J. Thevelein, J M, " Different signalinthe osmotic stress conditions. The increased maximumspecific growth rate of ZAL69 further more supportedstress in Saccharomyces cerevisiae. Microbiol, 145, 715- 727(1999).6 Ohmiya, R, Yamada, H, Nakashima, K, Aiba, H, Mizuno, T,The ethanol yield and glycerol yield of ZAL808coding glycerol-3-phosphate dehydrogenase, one of which is re-increased 6.66% and decreased 41.7%, respectivelyThis suggested that simultaneous over-expression of 7 Remize, F.Barnavon. L. Dequin, S, "Glycerol export and glye.GLTI and GLNI in fp△gpd2△ mutant can Increaseerol-3-phosphate dehydrogenase, but not glycerol phosphatase, areethanol yield compared with wild type. But the etharate limiting for glycerol production in Saccharomyces cerevisiaenol yield of ZaL808 is lower than that of ZAL69 OneMetah.Eng,3,301-312(2001possibility might be that the combined effects of dele8 Nissen, T L, Kielland-Brandt, M.C., Nielsen, J, villadsen, J, " Op-tion of FPS/ and GDP2, and over-expressicon oftimization of ethanol production in Saccharomyces cerevisiae byGLNI and GLTI of S cerevisiae to improve ethanolmetabolic engineering of the ammonium assimilation", Metab. Eng2.6977(2000yield are not useful9 Bakker, B M, Overkamp, K M, van Maris, AJ, Kotter, P, Luttik.As shown in Table 4, compared with wild type.M.A., van Dijken, J.P., Pronk, J.T., "Stoichiometry and compart-acetic acid yield of ZAl69 and ZAL808 decreasedof NADh metabolism in Saccharomyces cerevisiaemicrobiol.Rev,25,15-37(2001)63. 4% and 68.8%, respectively, and the pyruvic acidT L Hamann, C w Kielland-Brandt M C. Nielsen, J.ield of Zal69 and Zal808 decreased 61.1 %o andJ, "Anaerobic and acrobic batch cultivations of Sac54%. The decrease of acetic acid and pyruvic acidcharomyces cerevisiae mutants impaired in glycerol synthesisyield are the examples of a metabolic regulation byYeas,16,463-474(2000)the cells to minimize the NADh surplus when glyc-11 Valadi, H, Larsson, C, Gustafsson, L, "Improved ethanol produc-erol synthesis capacity is hampered. According totion by glycerol-3-phosphate dehydrogenasemyces cerevisiae", AppL. Microbiol. BiotechnoL, 4. 434-439(1998)metabolic flux analysis of Saccharomyces cerevisiae12 Zhang, A Kong, Q, Cao, L Chen. x, "Effect of FPSi deletion on[17, when glycerol yield, acetic acid yield, and pyru-es of Saccharomyces cerevisiae", Lett. AppL.vic acid yield decreased, the metabolism must shiftMicrobiol.44(2),212-21702007).towards ethanol In our research, glycerol yield, aceticBurke, D, Dawson, D, Steams, T. Methods in Yeast Genetics: ACold Spring Harbor Laboratory Course Manual, Cold Spring Harborcid yield, and pyruvic acid yield of ZAL69 andLaboratory Press, New York, 174(2000)ZAL808 decreased dramatically, whereas ethanol14 Gietz, R D. Sugino, A, "New yeast Escherichia coli shuttle vectorsyield of ZAL69 and ZAL808 increased 9.81% andconstructed with in vitro mutagenized yeast genes lacking six-base3.48%, which verified the metabolic flux analysis ofair restriction sites", Gene, 74, 525-534(1988Nissen et al. [171ritsch, EF, Maniatis, T, Molecular Cloning: ALaboratory Manual, 2nd edition, Cold Spring Harbor LaboratoryIn conclusion, our research demonstrates thatPress, New York(1989).ethanol yield of ZAL69 and ZAL808 increased 1613. 17% and 6.66%, respectively, whereas the glycerol中国煤化工of sac.yield, acetic acid yield, and pyruvic acid yield ofrobot. BZAL69 and ZAL808 decreased dramatically. TheCNMH, erlandsen,J,“ Flux diethanol yield of strain ZAL808 Ps IA: LEU2tions in anaerobic, glucose-limited continuous cultures of Sacgpd24: URA3 PPGKT-GLTI PPGKI-GLND) was highercharormyces cerevisiae". MicrobioL, 143, 203-218( 1997)than that of4, but was lower than ZAL69